About
I'm a first-year Ph.D. student in Computer Science at Florida State University. My research direction is centered on computational biology and bioinformatics, with an emphasis on machine learning methods for biomedical data.
Current goals: build strong baselines, learn the biology behind the data, and produce reproducible results.
"Make it reproducible." → versions + seeds + scripts + logs "Measure everything." → baselines + ablations + honest metrics "Respect the biology." → assumptions + confounders + validation
Education
Florida State University
Fall 2025 — Present
Ph.D. in Computer Science • Tallahassee, FL
GPA: 4.00 / 4.00 (current) • Focus: Computational Biology and Bioinformatics
SRM Institute of Science and Technology
2020 — 2024
B.Tech in Computer Science and Engineering • Chennai, India
CGPA: 9.53 / 10
Research
Graduate Research Assistant (GRA) • Florida State University • Fall 2025 — Present
- Conducting research in computational biology and bioinformatics using machine learning approaches.
- Designing and evaluating models for biomedical data analysis and disease detection.
- Working with large datasets on Linux-based HPC clusters (batch scheduling, reproducible workflows).
- Building preprocessing + training + validation pipelines in Python (NumPy/Pandas, scikit-learn, PyTorch).
- Documenting experiments (configs, seeds, ablations) to support reproducibility.
Teaching
Graduate Teaching Assistant (TA) • Florida State University • Fall 2025 — Present
Courses TA'd
- CGS2060 — Computer Fluency (Term: Spring 2026, Fall 2025)
- CGS2100 — Microcomputer Applications for Business/Economics (Term: Spring 2026, Fall 2025)
Responsibilities
TA
- Conducting office hours to support students with problem solving.
- Providing feedbacks on grading based on consistent rubrics.
- Helping solve projects, explain concepts, and keep course logistics running smoothly.
Relevant Coursework
Florida State University (PhD)
Fall 2025 — Present
- COT5507 — Analytic Methods for Computer Science
- CAP5540 — Bioinformatics - Sequence Analysis
- COT5405 — Advanced Algorithms
- CAP5638 — Pattern Recognition
SRMIST (B.Tech)
2020 — 2024
- 18CSC305J — Artifical Intelligence
- 18NTO403T — Scientific Research Principles
- 18GEO104T — Computational Genomics
- 18CSC201J — Data Structures and Algorithms
- 18ECO108J — Embedded System Design
Publications
Detection of Pneumonia Using Machine Learning
Pankaj Bhattarai; K. A. Varun Kumar; Balachandar T; Rashmi Od • ACM ICIMMI 2023
Patents
AI Based Plant Extract Analysing Device to Identify Disease
Design No. 392971-001 • Granted by the Patent Office, Government of India
Talks & Presentations
Detection of Pneumonia using Machine Learning
Dec 2023
5th International Conference on Information Management & Machine Intelligence (ICIMMI 2023)
Selected Projects
These can be rewritten into stronger, results-style bullets once details are available.
- Detection of Cyber Attacks on Internet Connected Vehicles — security analytics and anomaly detection.
- Plant Disease Detection System — AI-based classification workflow.
- AI Chatbot using NLP — NLP + ML pipeline experimentation.
- Face-based Authentication System — applied computer vision prototype.
- C Header for Vector Manipulation — low-level data structure utilities.
Skills
Skills
Python
C/C++
ML: scikit-learn, PyTorch
Data: NumPy, Pandas
Scientific computing
HPC: Linux clusters, batch scheduling
Reproducibility: Git, LaTeX
Databases: SQL/NoSQL
Web dev & hosting
FASTA>demo ATGCGTACGTTAGCAGGTTACGTAACGTAA read_001 ATGCGTACGTTAGCA--GTTACGTA ref ATGCGTACGTTAGCAGGGTTACGTA
Honors & Awards
Winning Team — SRM Smart Campus Hackathon
2023
Compex Scholarship — Government of India
2020
Contact
Best way to reach me is email.
Collaboration: if you're working on bioinformatics / computational biology, I’m happy to chat.